KEGG   Bacillus cereus ATCC 14579: BC0270Help
Entry
BC0270            tRNA      T00127                                 

Definition
(RefSeq) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
bce  Bacillus cereus ATCC 14579
Pathway
bce00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bce00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BC0270
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bce03100]
    BC0270
Non-coding RNAs [BR:bce03100]
 Transfer RNA
  tRNA
   BC0270
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 1202623
Position
244004..244093
Genome map
NT seq 90 nt NT seq  +upstreamnt  +downstreamnt
gagaagtacccaagtggctcaaggggctcccctgctaagggagtagatcgctaacgcggt
gcgagggttcgaatcccttcttctctgcca

DBGET integrated database retrieval system