KEGG   Burkholderia cenocepacia J2315: BCAM0507Help
Entry
BCAM0507          CDS       T00771                                 

Definition
(GenBank) CsbD-like protein
Organism
bcj  Burkholderia cenocepacia J2315
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: CsbD
Motif
Other DBs
NCBI-ProteinID: CAR54364
UniProt: B4EK09
Position
2:561951..562142
Genome map
AA seq 63 aa AA seqDB search
MDRNRVEGKLKQVKGSVKEALGKVTGDRETEAEGLAEQQAGKLQEKAGEAADAMRKHTGT
DRH
NT seq 192 nt NT seq  +upstreamnt  +downstreamnt
atggacaggaatcgcgtcgaaggcaagctcaaacaggtcaagggttcggtcaaggaagca
ctcggcaaggtgacgggcgaccgcgaaaccgaagcggaaggcctggccgaacagcaggcc
ggcaagcttcaggagaaggccggcgaggcggccgatgcgatgcgcaagcatacgggcacc
gatcggcactga

DBGET integrated database retrieval system