KEGG   Burkholderia cenocepacia J2315: BCAMr0437Help
Entry
BCAMr0437         misc_RNA  T00771                                 

Definition
(GenBank) yybP-ykoY element as predicted by Rfam, score 66.75
Organism
bcj  Burkholderia cenocepacia J2315
SSDB OrthologParalogGene clusterGFIT
Position
2:complement(494124..494242)
Genome map
NT seq 119 nt NT seq  +upstreamnt  +downstreamnt
ctctccgtctttggggagtagcctgctttccgcccccggaaagcgaacgcgtcaacacac
tcggcttgcggccgtggcgcgttcggcctgatcggcttggcgagaccatcggcacatcg

DBGET integrated database retrieval system