KEGG   Bacillus cellulosilyticus: Bcell_R0029Help
Entry
Bcell_R0029       tRNA      T01389                                 

Definition
(GenBank) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
bco  Bacillus cellulosilyticus
Pathway
bco00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bco00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Bcell_R0029
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bco03100]
    Bcell_R0029
Non-coding RNAs [BR:bco03100]
 Transfer RNA
  tRNA
   Bcell_R0029
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
184230..184304
Genome map
NT seq 75 nt NT seq  +upstreamnt  +downstreamnt
ggcccgttggtcaagtggttaagacaccgccctttcacggcggtaacacgggttcgaatc
ccgtacgggtcacca

DBGET integrated database retrieval system