KEGG   Burkholderia glumae BGR1: bglu_1g01380Help
Entry
bglu_1g01380      CDS       T00905                                 

Definition
(GenBank) Gp41, LysC
Organism
bgl  Burkholderia glumae BGR1
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ACR27340
UniProt: C5A8R1
Position
1:complement(145824..146090)
Genome map
AA seq 88 aa AA seqDB search
MATNRFAPGLIALSLAMLCACTQAPPSPAATITLRECATVTRCTMPAMQPRSNGELSNAL
QAARAAWARCAAEVDMVAACQAKAGRDE
NT seq 267 nt NT seq  +upstreamnt  +downstreamnt
atggcaacgaatcgattcgcgcctgggctgatagccctctccctggcgatgttgtgcgcc
tgcacgcaagccccgccctcaccggcggcgacgattacgcttcgcgagtgcgcgacggtg
acgcgctgcacgatgccggcgatgcagccgcgcagtaacggcgagctgagcaacgctcta
caggccgcgcgggcagcgtgggcgcggtgcgcggccgaggtcgacatggtggccgcatgc
caggcgaaggcggggcgcgatgaataa

DBGET integrated database retrieval system