KEGG   Bradyrhizobium diazoefficiens USDA 110: Bjat50Help
Entry
Bjat50            tRNA      T00109                                 

Definition
(RefSeq) tRNA-OTHER
  KO
K14232  tRNA Pro
Organism
bja  Bradyrhizobium diazoefficiens USDA 110
Pathway
bja00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bja00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Bjat50
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bja03100]
    Bjat50
Non-coding RNAs [BR:bja03100]
 Transfer RNA
  tRNA
   Bjat50
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 3399565
Position
2812727..2812803
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
cggagtgtggctcagcccggtagagcactgcgttcgggacgcaggggtcgcaggttcgaa
tcctgccactccgacca

DBGET integrated database retrieval system