KEGG   Bradyrhizobium diazoefficiens USDA 110: bll8206Help
Entry
bll8206           CDS       T00109                                 

Definition
(RefSeq) maturase; reverse transcriptase
Organism
bja  Bradyrhizobium diazoefficiens USDA 110
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 1048296
NCBI-ProteinID: NP_774846
RhizoBase: bll8206
UniProt: Q89BE9
Position
complement(9008410..9008970)
Genome map
AA seq 186 aa AA seqDB search
MHDTEKSDSGIVAEKPTNKAGLLAAEWAEPRPGTKGNAEQQRMHRTQGRARMTQSLDRVR
TAARLRKKDRFTALFHHINVDTLRAAFFALRRKAAPGVDGMTWEDYEEDLEPRLADLHKR
VQRGAYRPQPSRRTYIPKADGKQRPLAIAALEDKIVQGANRHRAQRHLRRRLLWLFLRVS
ARQRTT
NT seq 561 nt NT seq  +upstreamnt  +downstreamnt
atgcacgacacggagaagtctgactctggcatagtagctgagaagccaacgaacaaagcc
ggattactggcggcggagtgggcggagccaaggccggggaccaagggaaacgcggaacag
cagcgcatgcaccggacacagggccgggctcgcatgacccagtcgctggaccgcgtacgg
acagccgcaaggctgaggaagaaggaccggttcaccgcgctctttcaccacatcaatgtc
gatacactgcgggcggcgttctttgcgctcaggcgtaaggctgctcccggagtggatggc
atgacgtgggaggactacgaggaagatctcgagccccggctcgccgatctgcacaaacgg
gtccaacgaggagcgtatcgcccgcaaccgtctcgccggacgtacataccaaaggcagac
ggcaagcagcgcccgttagcgatcgcggctctcgaagacaaaatcgtccagggcgccaac
cgtcatcgtgctcaacgccatctacgaaggagacttctgtggcttttcctacgggtttcg
gcccggcagaggaccacatga

DBGET integrated database retrieval system