KEGG   Bradyrhizobium diazoefficiens USDA 110: bsr2532Help
Entry
bsr2532           CDS       T00109                                 

Definition
(RefSeq) hypothetical protein
Organism
bja  Bradyrhizobium diazoefficiens USDA 110
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: DUF2007 Propep_M14
Motif
Other DBs
NCBI-GeneID: 1050328
NCBI-ProteinID: NP_769172
UniProt: Q89S73
Position
2767326..2767553
Genome map
AA seq 75 aa AA seqDB search
MRELVRTNDMVLVSAIGALLDGANIHHLVLDQNMSIIEGSLGILPRRILVHEDDAQEARQ
LLTEAGLSHELRGDD
NT seq 228 nt NT seq  +upstreamnt  +downstreamnt
ttgcgtgaactggttcggaccaacgatatggtgctggtgtcggcgatcggcgcgctgctc
gacggcgccaatatccatcatctggtgctggaccagaacatgagcatcatcgagggctcg
ctcggcattttgccgcggcggatcctggtccatgaggacgacgcccaggaggcccggcag
ctcctgaccgaggcggggctcagccacgaactgcgcggcgatgattga

DBGET integrated database retrieval system