KEGG   Bradyrhizobium diazoefficiens USDA 110: bsr8266Help
Entry
bsr8266           CDS       T00109                                 

Definition
(RefSeq) hypothetical protein
Organism
bja  Bradyrhizobium diazoefficiens USDA 110
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 1048139
NCBI-ProteinID: NP_774906
RhizoBase: bsr8266
UniProt: Q89B98
Position
9055629..9055874
Genome map
AA seq 81 aa AA seqDB search
MRGRVAAGRVRHAEIQPLRGRQSNYRLLVARTARELLRVVGVEKRSLRSTAVLRPPAEAV
NDESAGLRSRAQISGKWLFLY
NT seq 246 nt NT seq  +upstreamnt  +downstreamnt
gtgcgtgggcgtgtggcggcgggcagggtgaggcatgccgagatccaaccgctgcgcggg
cgacagtcaaattatcgattactggtggctcggaccgcgcgcgagctactgcgcgtcgtg
ggtgtggaaaagcgctcactgcgatcgacagcggttttgcgcccgccggccgaggcggtg
aacgacgagagcgcggggcttcggtcccgcgcccagatcagcggaaaatggttgttccta
tattga

DBGET integrated database retrieval system