KEGG   Bifidobacterium longum subsp. longum JDM301: BLJ_0089Help
Entry
BLJ_0089          gene      T01240                                 

Definition
(GenBank) pseudogene
Organism
bll  Bifidobacterium longum subsp. longum JDM301
SSDB OrthologParalogGene clusterGFIT
Position
117074..117927
Genome map
NT seq 854 nt NT seq  +upstreamnt  +downstreamnt
gtgcctgcggcagttgtccctgcatatttgcagggaggcaatcgtttcgatggatatgat
gactgcttgagttccgaggtcagcatcaagaagatgtcggtctggttcgaaaaaatgacc
gcgcgggagtaccgcaagggaaccgtgataccggaattccgggcggtgcggcgcgtggtc
acggattgccttcgcctgttgaccggcttcgacgacgccagcatcgcctacgacggcggt
ttcgtggtcagttacacggcatccgacggaaaacatacatggaggatcagccgttcgaaa
ctctgagcgacggctatcgcgtagtcatcgggttggtggccgacatagcgcggcgtatgg
cacagctcaaccccttcctcgccgaacaggctgttgcgcgaactcccggagtggtgctta
tcgacgaggtggatctgcatctgcaccccaaatggcaggggaagatcctgggcgttttgc
atgaattgttccccttggtgcaattcatcgtcaccacgcatgccccgatggtgatctcct
cggtacaatccaagaatctacgggtgatcgagccggtcgatggcggtgacggcaagtacg
tcgccgtctctccggacgacgaaacgtacggtgtcaacgccggggcgatactgcgcgaag
tcatggtgaccccggataagccggcggcggttcaggacaaactggatgaattcggccagt
atctgaacgacaaagaatacggcaaggctcaagcgacgctacgagcgttgcagaacgagg
taggggaagacaacccggatctgagcaacgcgtgggccgcgtattatttcgccgtgccgg
cgccggacgcgtga

DBGET integrated database retrieval system