KEGG   Bifidobacterium longum subsp. infantis ATCC 15697 (JGI): Blon_R0035Help
Entry
Blon_R0035        tRNA      T00794                                 

Definition
(GenBank) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
bln  Bifidobacterium longum subsp. infantis ATCC 15697 (JGI)
Pathway
bln00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bln00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Blon_R0035
Non-coding RNAs [BR:bln03100]
 Transfer RNA
  tRNA
   Blon_R0035
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
1334178..1334253
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
gcggacatagcttagttggtaaagcgcaaccttgccaaggttgagaccgcgggttcgagt
cccgttgtccgctcta

DBGET integrated database retrieval system