KEGG   Bifidobacterium longum subsp. infantis ATCC 15697 (JGI): Blon_R0036Help
Entry
Blon_R0036        tRNA      T00794                                 

Definition
(GenBank) tRNA-Cys
  KO
K14222  tRNA Cys
Organism
bln  Bifidobacterium longum subsp. infantis ATCC 15697 (JGI)
Pathway
bln00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bln00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Blon_R0036
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bln03100]
    Blon_R0036
Non-coding RNAs [BR:bln03100]
 Transfer RNA
  tRNA
   Blon_R0036
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
1334278..1334348
Genome map
NT seq 71 nt NT seq  +upstreamnt  +downstreamnt
ggtgggttagccaagcggttaggcagcggcctgcaaagccgtatagacgagttcgactct
cgtacccacct

DBGET integrated database retrieval system