KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_05345Help
Entry
BMULJ_05345       CDS       T00740                                 

Definition
(GenBank) hypothetical protein
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: PAAR_motif DUF4469
Motif
Other DBs
NCBI-ProteinID: BAG47183
UniProt: A0A0H3KPN1
Position
2:complement(2440770..2441024)
Genome map
AA seq 84 aa AA seqDB search
MPARVATLGTLTTHGGAVTSASAGVAINGRPAACVGDAVSCPLHGAGVITNGGVGTINGR
QIAHHGSGTSCGATLVVSDDGPTV
NT seq 255 nt NT seq  +upstreamnt  +downstreamnt
atgccagcccgcgttgcaacccttggcacattgaccacccacggtggcgcggtcacatca
gcgagcgcaggcgtcgcgatcaatggacgtcccgcggcatgcgtcggcgacgcggtgtca
tgtccgctacatggcgcgggcgtcatcaccaacggcggcgtcggcacgatcaacggccgc
caaattgcccatcacggcagcggcacgagttgcggcgcgacgcttgtcgtgtccgacgac
ggcccgacagtctga

DBGET integrated database retrieval system