KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_05346Help
Entry
BMULJ_05346       gene      T00740                                 

Definition
(GenBank) pseudogene
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:complement(2445479..2451424)
Genome map
NT seq 5946 nt NT seq  +upstreamnt  +downstreamnt
atggtgaatttcaagacgaaccggaccttctcggtcagcggcccggcgctaccggacctc
gaaggcatcggcgcgatgctgcacctgagcgcgatgcggggcacggaacagctttccacg
ccgtacacgtacgaactctggctgacgacgcccgccgatccgcgactgccggccgagatg
ctggccaacctcgatctcaaggcgatgctcggcaaggaactgaccgtcacgatccagctg
gacgggatgggcagctttgtcgcggggatggccggccaggcgggcgcggggaacctgggc
gccggtacgcgagaaatcagcggcatcgtgacggcggccagctacgtggatcaactgaat
cgccagtgccgttatcgcgtcgtactggagccctggctggcactggcgcgcgagcggacc
gactatcgcatcttccaaaggaagagcgtgctcgacattctgcgcgaggtgttcggttcg
tattggtattcgttcgagatgcgcgtcggccgcacctacagaacgctgcgctatcaggtc
cagtacggcgaatcggacttcgcgtttgcccagcgcttgatggaggaacacggcatcgcg
tggttcttcgaacactcgcaaggcgtacaccgcctggtgctggtcgacggtccgggcgcc
tatcggagcgtggaaagtgtcgcgtatcagacgctcgagtactacccgccgggccggaag
atcgaccgcgagcacgtcgatcgcttcgaggcgacggagcgtctgcaatcgggcgtctgg
accaccgacgatttcgatttcgagaagccgggtgcgacgctgaccgcgcagaacagcttg
ccgcgcgagacggcgcacaaccagctcgaacgttacgaatggcccggcgactatacggaa
acggaggacggccacgcattcgcacaagtgcgcatggaggagattcacgcgcagggcgca
cgcgcgcaaggcgagggcaacctgcgcaacgtggtgtgcggcacgacgttcgtgctggcc
ggccatccgatggcgagcgccaaccgcgagtatctggtgatcgcgtcggagctggacgtg
aaggaaaccggcgagacgaccggcttctccgcctacgcgattcgcagcaggttcaccgta
cagccgtccgacgttgtattccgtccgccgcgcacgatcaggaaaccgcgtacgcgcggc
ccgcagacggcgatcgtgacgggcccgccggacgcggagatctggacgaacaagaacggc
gaggtgacgctcaagttccattgggaccgatccgacgtgaaggatcagaactcgtcctgc
tgggtgcgcgtgtcctatccgtgggccggcagcaacttcggcggcattcatgttccgcgg
gtcggcaccgaagtcatcgtcgatttcgaaaacggcgatccggatcgaccgatcgtgacg
gggcgcgtctacaacgcgatgacgatgccgccgtggaggctgccggctcacgcgacgcaa
agcgggatcctcacgcgctcgaccaagggcggcggatacggcaacgccaatgcgatccgc
ttcgaggacaagaaaggagcggagcaggtctggatccaggccgagcgcaatctcgatgcg
gtgatcgaggccgacgaaacgcacacggtcgggcatgaccgcacgaagcggatcggccac
gatgaaaccgaccagatcgggcgacactggacgctgtcgaccggcggctacaagttcgag
accgtgacgctggcgtcggtgaagagcgtgggcatgggcgcgatgttcaacgtcgggatg
gcctacaacgtcaacgtcggcgggctgtacctgcgcaacgtcgggctgcagatggccagc
acggtgggccgcagtcgcaccgaccgcgtcgtgcaggactggacggccgatgttgggcac
acctatacgctgaccgtgcgcggcaaggcggtgggcgatgccgtggccgccgatcgggcg
aatccgatcgagccgtcgcccgacttcgcgccgcagctgcccgcaccggtatcgagctcg
aacgccaaccagctgcgcatcgcggatacgggcgagagcagcctgtcgggcgcgaaacag
acgcaactgatcgggccgggcggcacggtgacgatcgacgagtccggcattcatctgaaa
ggcacggcgatttacctgcaggcgccgacgatcagcatgacgaacggcaatgccggtggc
ctcgcgccggtgaccgaagccgactgcgcggaatgcgcgaagaagagcgtcagtgcgaac
ccggtcgatctggcgacggggcagaaggtgctgtcgcatacggactttacgttgcccggc
cgcgtatcgatcgactggagccggagctaccgtagcgcggatcagcgccgcggcagtctg
ggcgttgcatggaagctgccgtatgcaacggaagtgcgcacgagcgcgacaggcttgatc
tacttcgacgccgacgggcggcagttgcagtttccggccttgaacccaggcgaagcgcat
ttccatccgatcgagaagttcacgctgatgcgcggtgacgacaacgcgtcgggcgccacc
tatgcgctgcgtttcggcaatggcgtcgaagagcattacggccgtcacccggtcgacgag
acgcgctggcaattgcaacgcatcgcgacgcgcgacggccagtgcctgacgctcggctat
acggcacagggctggttggaaacagttcgcaacaatgtgcataccgtgcgctgcgcgctc
gacgatgccggccggatcacgagcgtgttgctcgaccagggtgtcggcaatcagccgctg
cacctgacgagctacgtgtacgacgagcacggcgatctggtcgaggccaccgatcgcgag
aacctgacgtggcgctacggctacgacaaccatctgctgacgacctaccgcacgccggcc
ggcgcgacgcacgtatcggagtggagcgacgacacgccgaatgcgtactgcctgcggacc
tacgcctataccgaaggcgccgacgggcagcgagtcgtcacacgcgagatgcgtttcgat
tacctgccgtcgctgcgcgcgacgcgggtgacggacggcctcgggcatacgaccgaatat
cactacaacggcctgtgggcggtcgagaagatcgtgcatcccgacggcagtgtcgagcag
acgcatttcgacgagacggggagcgtggccggctacacggatgcactcggtcgcacgacg
cggatcgtgaacgatgcgcgcggcaatccgacgtcgatcatcgacccggccggcaacgtc
acgcgcatcagctatggcgagcacaacctcccggaacagattaccgacccggccgggcag
atctggcagcgcggctacgatgcgcacggtcacctgacgagcgaaaccgatccgctcggc
aacgtgacgcgttacgcctacgaaaacggcttgcccgtcgcgcgcacggatgcactgggg
aacgtgacgaagatgcaatgggacgacgcgggtcagctcgtggcgcgcaccgattgctcc
ggacacacgacgacctatgactacgatccgttcggccagttgaccgagaccaccgacgcg
ctcggtcaggtgagccaccacagcggcagcgtgtctgcgcgcgtgacggcggtgcagccg
gccggcatgggctggtggaaggtcgaatacgacgaagcgggtcgcgcgatcgcgcatacg
gatccgctcgagcgcgtgacgcgcgtggactgggacggttacgggcagcgaacgcagatc
gtcgatccggcgggcgggacgcaacagttccgatatgacgcgatcggccgtttgacgaag
ctcaccaatgcgaaccaagagacgactacgttccgctacgacagccgcaaccgcttgatc
gaacagaccggcttcgacggccgtcggcagagctaccggtacaacgcggcgggcgaactg
gtcgagcgcatcgatcacggccaggacggacagatcgcgacgcacgtgacctacgacgtg
cttggccgcccggtggagcgacgctcgagcgatgggagccaagcgagctatcgctacgac
gagcgcgggctgctgacgcaggcgcaggcgatcgtgcccgggcgtgcgccggtgcacgtc
acttacgaatacgacgcagccgggcgccgcacggcggaggtgcaggcgcatcacgggcgg
gtctggcggctcacgcacggcgtggacgcgatcgggaatcgcgactggacgcacgtgccg
gacatcggttcgctggtctggcagcgctacggctcggggcatgtgcacggcatcctgctc
gacgagcatccgctggcgagtttcgagcgcgacgcgctgcatcgggaaatccggcgtacg
caaggtccggcgtcgcatcacttcgggtatggcgcgaatggcctgctggcggtgcatcgc
tggcagaacctcgatgaacgggggcgctcgctggagcatccgcggccgtggcgggcgtgg
gcatacgacgacgccggtcagctgacgacgctggacgatgcgtggcgcgatcagaaggcg
tatcggtacgacgcgctatcgcggctgacgcaggtgatggcggcgagcggaccggaagcg
tttcattacgatccggcgggaaacctgctggctgctgcgccgagccgggacaacatgcag
gcgtggaaggcgagcggcgatcgcttgctgcggtttgcgccgcagacgcgcccggatcgt
ccggtggattttacgtacgacgggcatggcaatcgcattgcgcggacggtgccgttgccg
ccgaagccggcgctgacggaagcggagaagcgcagccagcgcgggacggacaacctgctg
cgcgtgatggaagtgctgacggggacgccgaagtacgaggagccgtcggaagtgccggag
gtgacgcggtatcggtacgacggcagccaccagttgatcgcgatcgaacatgcggacggg
gcgagaagcgagtacgaatacgacgcgctcggtcggcgggtggcgaagcatcacacgccg
gcgggcggcgcgcagcagacgacgctgttcatgtgggacggcgactggatgatgcaggag
gtgcgcacggggcgcacgtcgcatgaggacagggcggtgacctatgtgccgcatccggat
catgaaggaccgttgacgcggctggcggatgggcaggcgtggcactacgtgacggatcac
ctggggacgccgcaggaactgtacgacgaacagcgcgaggtgttgtgggcggcagatttg
agcgcgtatggacgtacggcgaggtggttgacgcgtgttgttgacaatccgatacgtttt
ccggggcagtaccgggatgaggagtcagggctgcattacaaccggttcaggtactacgat
ccgatggtggggcggtatatcaatcaggatccgatcgcctttgatggtggaatcaatttt
tacagctatgcagatagtgcgcctaacattgcttacgatccgaaaggcctatttgttcca
ttgatcgctgttgcttcatttttggggagaggggcgcttggtggggcggtcgaaattgct
atgcaaggggcaaagcaagtattcaggcaagcaaaaaataattgggttgatgggcgtccg
ctaaccgatattgattgggattgcgtaaaaatcgactggacagatgtgggggtttcagtc
gccgtcggaggcgtggcgcctagtttgggggcgactagaaaaagcgtaactagatccata
aaagccattagaaatctatctaatcaatccgctaacacggcaaatcgcgcggcaaaattg
aaggtgcgcgttgacattaaaaaggattcaatcaaacgcgatttgatcgtgcagggggca
tggcaaggaattaagcagggtgcaaagtgtgcttttggtgaggagaaaaaatgcgaggaa
gagtag

DBGET integrated database retrieval system