KEGG   Bombyx mori (domestic silkworm): 102464576
Entry
102464576         miRNA     T02817                                 

Gene name
Mir3328, bmo-mir-3328
Definition
(RefSeq) microRNA 3328
Organism
bmor  Bombyx mori (domestic silkworm)
SSDB
Other DBs
NCBI-GeneID: 102464576
miRBase: MI0014386
Position
Un
NT seq 25 nt   +upstreamnt  +downstreamnt
tgtttgtgcacttcagggaatctat

DBGET integrated database retrieval system