KEGG   Bombyx mori (domestic silkworm): 102466074Help
Entry
102466074         miRNA     T02817                                 

Gene name
Mir3406, bmo-mir-3406
Definition
(RefSeq) microRNA 3406
Organism
bmor  Bombyx mori (domestic silkworm)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 102466074
miRBase: MI0014470
Position
Un
NT seq 25 nt NT seq  +upstreamnt  +downstreamnt
tagtaagtagcacgtttgatgagca

DBGET integrated database retrieval system