KEGG   Burkholderia multivorans ATCC 17616 (JGI): Bmul_R0073Help
Entry
Bmul_R0073        tRNA      T00624                                 

Definition
(GenBank) tRNA-Ile
  KO
K14227  tRNA Ile
Organism
bmu  Burkholderia multivorans ATCC 17616 (JGI)
Pathway
bmu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bmu00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Bmul_R0073
Non-coding RNAs [BR:bmu03100]
 Transfer RNA
  tRNA
   Bmul_R0073
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
2:325108..325184
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
gggtctgtagctcagtcggttagagcaccgtcttgataaggcgggggtcgttggttcgaa
tccaaccagacccacca

DBGET integrated database retrieval system