KEGG   Burkholderia multivorans ATCC 17616 (JGI): Bmul_R0076Help
Entry
Bmul_R0076        rRNA      T00624                                 

Definition
(GenBank) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
bmu  Burkholderia multivorans ATCC 17616 (JGI)
Pathway
bmu03010  Ribosome
Brite
KEGG Orthology (KO) [BR:bmu00001]
 Genetic Information Processing
  Translation
   03010 Ribosome
    Bmul_R0076
Ribosome [BR:bmu03011]
 Ribosomal RNAs
  Prokaryotes
   Bmul_R0076
Non-coding RNAs [BR:bmu03100]
 Ribosomal RNA
  Large subunit rRNA
   Bmul_R0076
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
2:328590..328702
Genome map
NT seq 113 nt NT seq  +upstreamnt  +downstreamnt
cctgatgaccatagcgagtcggtcccaccccttcccatcccgaacaggaccgtgaaacga
ctctacgccgatgatagtgcggattcccgtgtgaaagtaggtaatcgtcaggc

DBGET integrated database retrieval system