KEGG   Bifidobacterium animalis subsp. animalis ATCC 25527: BANAN_00145Help
Entry
BANAN_00145       CDS       T02047                                 

Definition
(GenBank) hypothetical protein
Organism
bni  Bifidobacterium animalis subsp. animalis ATCC 25527
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AFI62256
Position
31667..31834
Genome map
AA seq 55 aa AA seqDB search
MLLDKDAGMQFSHTLGEQIGGQLEADSRCARCMRTRMARGICANTMCRRSSRREV
NT seq 168 nt NT seq  +upstreamnt  +downstreamnt
atgctgctcgacaaagacgccggcatgcagttctcgcacacgctcggcgagcagatcggc
ggccagctcgaggcggattcacgctgcgcgcgttgtatgaggacacgaatggcgagggga
atctgcgcgaacaccatgtgccgacgttcgtcgcgacgtgaagtgtga

DBGET integrated database retrieval system