KEGG   Bifidobacterium animalis subsp. animalis ATCC 25527: BANAN_t07849Help
Entry
BANAN_t07849      tRNA      T02047                                 

Definition
(GenBank) tRNA-Ile
  KO
K14227  tRNA Ile
Organism
bni  Bifidobacterium animalis subsp. animalis ATCC 25527
Pathway
bni00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bni00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BANAN_t07849
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bni03100]
    BANAN_t07849
Non-coding RNAs [BR:bni03100]
 Transfer RNA
  tRNA
   BANAN_t07849
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(19633..19706)
Genome map
NT seq 74 nt NT seq  +upstreamnt  +downstreamnt
gggcccgtagctcaggtggttagagcgcatccctgataaggatgaggtcggaggttcaag
tcctcccgggccca

DBGET integrated database retrieval system