KEGG   Bordetella pertussis Tohama I: BP2050Help
Entry
BP2050            CDS       T00139                                 

Gene name
rpmG
Definition
(RefSeq) 50S ribosomal protein L33
  KO
K02913  large subunit ribosomal protein L33
Organism
bpe  Bordetella pertussis Tohama I
Pathway
bpe03010  Ribosome
Module
bpe_M00178  Ribosome, bacteria
Brite
KEGG Orthology (KO) [BR:bpe00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    BP2050 (rpmG)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:bpe03011]
    BP2050 (rpmG)
Ribosome [BR:bpe03011]
 Ribosomal Proteins
  Mitochondria/ Chloroplast
   Large subunit
    BP2050 (rpmG)
  Bacteria
    BP2050 (rpmG)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Ribosomal_L33
Motif
Other DBs
NCBI-GeneID: 2667548
NCBI-ProteinID: NP_880717
UniProt: Q7VWY2
Position
complement(2169933..2170100)
Genome map
AA seq 55 aa AA seqDB search
MAKDIREKIKLESTAGTGHFYTTTKNKRNMPEKMLIKKFDPVARKHVDYKETKLK
NT seq 168 nt NT seq  +upstreamnt  +downstreamnt
atggccaaagatatccgcgaaaagatcaagctcgagtcgactgccggcacgggccacttc
tacacgaccaccaagaacaagcgcaacatgcccgaaaagatgctgatcaagaaatttgat
cccgtcgctcgcaagcatgtcgactacaaagagaccaagctgaagtaa

DBGET integrated database retrieval system