KEGG   Bordetella pertussis Tohama I: BP2064Help
Entry
BP2064            gene      T00139                                 

Definition
(RefSeq) pseudogene
Organism
bpe  Bordetella pertussis Tohama I
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 2666590
Position
2183705..2185246
Genome map
NT seq 1542 nt NT seq  +upstreamnt  +downstreamnt
gtgagcaacgccaacctatatgctgtgctggaggggggcttccccgccgatcgcgaccgc
gtggcgctggagaccccgacgctgcgctatacctggaacgacatcgaccgcgccagcgcc
tgcctggccaatctgctggcctcgctgaagctgccggccggcgcgcgggtggcggtgcag
gtcgagaagtcgcccgaggcgctgctgctgtacctggccacgctgcgcgcgggactggtc
tacctgccgctgaacacggcctaccgcgaagccgagatcgaatacttcctgggcaacgcc
gagccggccgtggtcgtgtgcaccagcgccaatgccggctgggtgcgccgcgccgccgcc
aaggcgggcagcgcgcacgtctacaccctggacgaagaccgtaccggcacgctgctgcag
gccgccgccgcgatgccgcagcgcttcaggacggtggcgcgcaaggccgacgacctggcc
gccatcctgtacacgtccggcaccaccggccgcagcaagggcgccatgctgtcgcacggc
aacctggcctccaatgcccgcgtgctgcactaatactggggctggcgcgaggacgacgtg
ctgttgcacatgctgcccattttccacgtgcatggcctgttcgtcgcttcgcacggggcg
ctgctggccggcgcgcgcatgatctggctgcccaggctggacgtggaccaggcgctgcgc
tatctgccgcagagcacggtcatgatgggcgtgcctacctattacgtgcggctgctggcc
gatgcgcgcttcgaccgcgcggcctgcgccaacatgcggctgttcatttccggctcggcg
ccgctgctgaccgagacgttcgccgatttccaggcccgcaccggccagaccatcctggag
cgctacggcatgagcgaaaccgtcatgctgacctccaatccctgccggcccgcggacggc
gaacgcctgggcggcacggtgggcaaggcgctgtcgggcgtgcaggtgcgggtggtggat
gacgcgggccaggctgtggcggccggcgagatcggcaacgtgcaggtgcgcgggccgaac
gtcttctccggctactggcgcatgcccgagaagacgcgcgaggaattcaccgccgatggc
tggttcaagaccggcgacgtgggccgctggggcggcgagtcgggcgggcgcgcggtgccg
gccgattacctgtcgatcgtcgggcgcagcaaggacctgatcatctcgggcggctacaac
gtctaccccaaggagatcgagacggtcatcgacgagatgcagggcgtgctggagtcggcc
gtcatcggcgtgccgcaccccgatttcggcgaggccgtggtggcggtggtggtgccgcgc
gccggcgcggcgatcgatgtcgccgccatgcaggccgacctgaagtcgcgcatcgccaat
ttcaaggtgcccaagcggatccacgtcgtggaccagttgccgcgcaacaccatgggcaag
gtgcagaagaacgttctgcgcgatacctacgccgcgtcctga

DBGET integrated database retrieval system