KEGG   Bordetella pertussis Tohama I: BP2101Help
Entry
BP2101            gene      T00139                                 

Definition
(RefSeq) pseudogene
Organism
bpe  Bordetella pertussis Tohama I
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 2667003
Position
complement(2223567..2225872)
Genome map
NT seq 2306 nt NT seq  +upstreamnt  +downstreamnt
atgggcgtgacctccatagcatggcaaaaacccctcctgtacaccgagaccgccatgccg
cactccaactacgcccgccacctcatgggctccgccaccatagatcccaccggcgccttc
gaggcgggcagcttcgccagcttcaccctcacctacaccgccggctacttcggcatcgac
gacaccggctcgatcaagatcgtgcaccgcttcgccagcgacatgggcaagccgcagttc
accgatccgcagggctggaactacaccaccgtcgaagccggcaatggcgcggtgctgcac
gtcgagtacgacggcaagcgcaatatccgcccgtgggacaagaccctgttcatccgcgtc
gtgcgcggctatctcgaggaaggcgaacagatcatcgtgcgcttcggcgatacccgccaa
ggctcgcccggcatgcgcgtgcagaccttccacgagccgaccttcgaattcaaggtgctg
tggtggacgctttcgccacgtacaactatgtcgagatcgaggcctcgccgacgatctccg
tggtggccggcccccctgtccggtacaaggccgtgctgcccagtctgtcgctggccggcc
agccgctgcgcctgggcttcaagggcgaggacaaatggggcaacccctccgaccaggcgc
agagccgctacaccctgcgcagcaacctgcgcatggcgcggatgcccgagtccttcgaaa
tggccgccggcgcctatgcccacgcgatcgaaggcatcgtcgccgccgagaccggcgacc
tgcgcctggaagtcctgcacggcgaccgggtcgtggcgcgcagcaacccgtgccgcgtcg
ccgcgcaggcggcgcgcaaccactactgggccgacctgcacggccagtcggaagagacca
tcggcaccaactccgccgaggagctcatcctgttcgcgcgcgaccgcgccttcctggacg
cgatgagccaccagggcaacgatttccagatcacccaggaattctgggagcacctgaacg
ccctgaccgcccgctacgacgaacccggccgcttcgtgatcttccccggctacgaatggt
cgggcaataccggcctgggcggcgaccgcaacgtgctgtacctgcacgaaggccgtccgc
tgcaccgttcgtcccacgccctggtggacgacctgtccgacctggactccgacgccaaca
gcgccgatgcgctgttccaggccatcaaggacgaggacgccgtcgtcttcgcgcacatcg
gcggccgctacgccgacatcacgctgtcgcacgacccgcgcatcgaacgctccatcgaaa
tccactccgactggggcacgttcgaatggctgctcgaggacgccttcaagcagggctacc
gtgtcggcatcctcgccaacagcgacggccacaagggacgccacggcgccagccatcccg
gcgcctcgctgttcggcgcctacggcggactgagctgcctgatcgccgacacgctgagcc
gccaatcgctggccgagtgcctgcgccagcgccgccactacgccaccaccggctgccgcg
cctacctggacgtggcggcgcacttcgatgcgccggcgcgccgctacgccgaagatccca
ggctcgcccccgatgccgcgagcacgcaggtgcgcagcgcggacatgggcgccatcctcg
cctgcgacaccggcatggtcgagttcgaattcgacctcgccaccgaggcgccgatcgaat
cggtggaagtgcgcaaccgcatggacgtggtccagaccctgcgtcccttcaagccagccg
acctgggccgccgcatccgcatcgtctgggaaggctcggagtaccgcggccgcggccggc
agaccgtatgggacggcagcgccacgctgcaagacaacgcctttgtcgaccccaaaccca
tcaatttctggaacctcgacaagacgctgcaacagccgcagcccaaccacctgtgctggc
agtcgctgaccacgggcggcttcagcggcgtggacgtgatgctcgaagacgccgggcgcg
gcacgctgtgcatcgacaccgaactgatccaggcgcgcatcccggtggccgacatcggcc
tggagccgctggtcttcgagaacggcggcatacgccggcgcctgcaagtgttccgcctgc
ccgacgaaaaccccgcctgccacctgaaggcgcgcgtgcaggtccccttgcatacgggac
aggacaacgccctgtacctgcgcgccacgacggaagacgggttcttcatctactccagcc
cgatctatatagaacgaaaggcgtaa

DBGET integrated database retrieval system