KEGG   Bordetella pertussis Tohama I: BP2123Help
Entry
BP2123            gene      T00139                                 

Gene name
aroG
Definition
(RefSeq) pseudogene
Organism
bpe  Bordetella pertussis Tohama I
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 2667628
Position
2246473..2247634
Genome map
NT seq 1162 nt NT seq  +upstreamnt  +downstreamnt
ttgcctgttgcgccgccggggcgcaccggagaaattgctttgacccgtatcgatgacccg
ctgcacgatcgcgaagccggccaggccgacgcgacgcaagacaccacccgcatcgacgac
gtgcgcatcggcgccgtgcgtcccctgatttcgcccgccctgctgcaggacgaactgccg
gtatcggcgccgctgcaggcgctggtcgagggaggacagccgcgcgcgcatcgccgacgt
gctgcacggccgcgacgaccggctggtggtggtggtcggcccctgctccatccacgacca
cgaacaggccatggagtacgcgcgccagctcaaggaggcggccgacacgctggccgacga
cctgctcatcgtcatgcgcgtgtacttcgagaagccgcgcaccaccgtgggctggaaggg
ctacatcaacgatccgcgcctggacggcagtttccgcatcaacgaaggcctgcgccgcgc
gcgccacctgctgctggaaatcggcgccctgggactgcccatcgccaccgaattcctgga
cctgctcagcccgcaatacatcgccgacctgatcgcctggggcgcgatcggcgcgcgcac
caccgaaagccccagccaccggcaactggcctcgggcctgagctacccgctgggtttcaa
gaacggcaccgacggcggcatccaggtggcggccgacgccatcgtggccgccagcgcccc
gcatgccttcatgggcatgaccaagatgggcaccgccgccatcttcgagacgcgcggcaa
cgacgacacccacgtcatcctgcgcggcggcaagcaaggccccaactacgacgcggccgc
catcgacgcctgctgtgcggcgctggccaaggccggcctgcgcgagcaggtcatggtcga
ctgctcgcacgccaattcgaacaagtcgcacgcgcgccaggtcgacgtggcgcgcgacct
ggcccggcaactggccggcggcgaccgccgcatcatcggcatcatgatcgaaagcaacct
cgaggaaggccgccaggatctcaagcccggcgtgccgctcaagcgcggcgtgtccatcac
cgacgcctgcctgagctgggcccagaccgagccggtgctggccgagctggcccaggccgt
gcgccagcgccgcaaaggctga

DBGET integrated database retrieval system