KEGG   Bordetella pertussis Tohama I: BP2136Help
Entry
BP2136            gene      T00139                                 

Definition
(RefSeq) pseudogene
Organism
bpe  Bordetella pertussis Tohama I
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 2665878
Position
2259960..2260373
Genome map
NT seq 414 nt NT seq  +upstreamnt  +downstreamnt
atggccatgagcgagcaggaccaccgggcctggatcgcggccggcaccagctgggtggcc
gaatgccccggcgccggattggcgggcttcctggtcgcggagcgcaccgccgatgcgctg
catgtctgggagctggcggtgcggcgcgaaatgcagggccgcggcatcggcgggcggctg
gtgcgggccgccatcgacgccgcggcggcggccggcctgcccgccatcacgctgaccacc
ttccgcgacctgccctggaaccagcccttctacgcgcgcctgggtttcgccacgctgcaa
gcggacggcctcaacgtgcgcctgcaggccatcctggcgcgcgaggccagcctgggcctg
ccggcggcgcgccgctgcgccatgcggcgcgagatcgcggcggcgcgccgctag

DBGET integrated database retrieval system