KEGG   Burkholderia pseudomallei 1106a: BURPS1106A_1659Help
Entry
BURPS1106A_1659   CDS       T00480                                 

Definition
(GenBank) hypothetical protein
Organism
bpl  Burkholderia pseudomallei 1106a
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ABN88850
UniProt: A3NUA9
Position
I:complement(1611154..1611285)
Genome map
AA seq 43 aa AA seqDB search
MGALGASGAAGAAGAESAPGGRARLRRTVAVPTARATTAHESL
NT seq 132 nt NT seq  +upstreamnt  +downstreamnt
ttgggtgcgttgggtgcgtcgggtgcggcgggtgcggcgggtgcggaaagcgcgcccggc
ggccgcgcgcggctgcgtcggaccgtcgccgttccgaccgctcgcgcgacaaccgcgcac
gaatcgctttaa

DBGET integrated database retrieval system