KEGG   Burkholderia pseudomallei 1106a: BURPS1106A_1669Help
Entry
BURPS1106A_1669   CDS       T00480                                 

Definition
(GenBank) conserved hypothetical protein
Organism
bpl  Burkholderia pseudomallei 1106a
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ABN90339
UniProt: A3NUB9
Position
I:1622936..1623280
Genome map
AA seq 114 aa AA seqDB search
MTAARISSRMLAPMPARPLPRAFSRASARAMTPRAASPRGERAAIAVIAACAPSAACAAC
AAQPTGRSRRLTQPPFSRLAPTCPRPNPFRCRAAPIATSCRSRRAGWTTTSTAT
NT seq 345 nt NT seq  +upstreamnt  +downstreamnt
gtgacggcggcgcgcatttcgtcgcgcatgctcgcgccgatgcccgcgcggccgttgccg
cgcgcgttttcgcgggcgtccgcccgcgcgatgacgccgcgcgcggcgtcgccgcgtggc
gaacgcgccgctatcgccgtcattgccgcttgcgccccttccgccgcttgcgccgcttgc
gccgcgcaaccgaccggccgctctcgacgcctcactcagccaccgttttctcgcctcgcg
ccgacatgtccccgaccaaacccgttccgctgccgcgcagcgcctatcgccacttcctgc
cgatcacgacgcgctggatggacaacgacgtctacggccacgtga

DBGET integrated database retrieval system