KEGG   Burkholderia pseudomallei K96243: BPSL1043Help
Entry
BPSL1043          CDS       T00203                                 

Definition
(RefSeq) lipoprotein
Organism
bps  Burkholderia pseudomallei K96243
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 3093837
NCBI-ProteinID: YP_107670
UniProt: Q63W46
Position
1:complement(1212731..1213282)
Genome map
AA seq 183 aa AA seqDB search
MNHRIARPARRWAAWATLGAAAFSTLLSGCNSLYSEGATAGAGIAGAAIASKVTSNAAVA
TGIGLGAVAGARAGVQYTQRVAHRYSQAQIAAAAGPLEVGGVAPWSTHHSFPIEDDEHGR
VTVSRLISVGPLDCKEIVFSVDTDAKGNEAAQSGFYVATICRDGPAWKWASAEPATGRWG
ALQ
NT seq 552 nt NT seq  +upstreamnt  +downstreamnt
atgaaccatcgcatcgcacggccggcgcgccgttgggccgcatgggccacactcggcgcc
gccgccttctcgacgctgctgtccggctgcaattcgctctatagcgaaggcgcgacggcc
ggcgcgggtatcgccggcgcggccatcgcgtcgaaagtcaccagcaacgccgctgtcgcg
accggcatcggcctgggcgccgtcgccggcgcgcgcgcgggcgtccagtacacgcagcgc
gtcgcgcatcgctattcgcaggcgcagatcgccgccgcggcggggccgcttgaggtcggc
ggcgtcgccccctggtcgacgcatcactcgttcccgatcgaggacgacgagcacggccgc
gtgaccgtgagccggctcatcagcgtcgggccgctcgactgcaaggaaatcgtgttctcg
gtcgacaccgacgcgaagggcaacgaggccgctcaatcgggcttctacgtcgcgacgatc
tgccgggacggccccgcgtggaagtgggcgtcggccgaacccgccaccggccggtgggga
gcgctgcaatga

DBGET integrated database retrieval system