KEGG   Burkholderia pseudomallei K96243: BPSL1051Help
Entry
BPSL1051          gene      T00203                                 

Definition
(RefSeq) pseudogene
Organism
bps  Burkholderia pseudomallei K96243
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 3091600
Position
1:1220648..1220917
Genome map
NT seq 270 nt NT seq  +upstreamnt  +downstreamnt
atgaagaagatcgcggcagtcctattgacggcgggcagcctcgcgctggcggggccggcg
agcgcgcacgatcgtggcggcgtcatcgtcggcgcgctgatcggcggcgcggtgctgggc
gcgatcgtgatgtccgcattgaatcccgcaccggccgttgcatatgcggcgccggcgtat
caggctccggcgtatcgggcgcccgctatcagccggcgcgatatcagccggcgccgcctt
acggtgcgcagccgtgggcgatcgctatga

DBGET integrated database retrieval system