KEGG   Burkholderia pseudomallei K96243: BPSL1131Help
Entry
BPSL1131          gene      T00203                                 

Definition
(RefSeq) pseudogene
Organism
bps  Burkholderia pseudomallei K96243
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 3094622
Position
1:complement(1315468..1315901)
Genome map
NT seq 434 nt NT seq  +upstreamnt  +downstreamnt
ttgctcagcgcatggacgcacgattcgtacgtcgagatcgacgcggaaaccggcgtgcgc
cacgcgccgttcggcgacgcgccgctcggcttcattgtctatacggccgacggctatatg
tccgtgcaattgcaggcgcgcgaacgcgcgccgttctccggcgacgatctgtacgcggca
cgcccgccgaatacgcgcaggcgggacgcacgtacctcgcgtatgcgggacgcttcttcg
tcgacgaagcgacgcgcgcgctgtcgcacgaaatggccgtcgcgcttttcccgaactggc
tcggccagatccagacgcgcatcgtcgagttccccgacgacacgctgcatctcggcatgc
cgacgccgctgcagttgaacgacgcgctcaagcacgcgcgcctcgtctggcggcgctcga
cgccgaacggatga

DBGET integrated database retrieval system