KEGG   Burkholderia pseudomallei K96243: BPSS1659Help
Entry
BPSS1659          CDS       T00203                                 

Definition
(RefSeq) hypothetical protein
  KO
K02433  aspartyl-tRNA(Asn)/glutamyl-tRNA(Gln) amidotransferase subunit A [EC:6.3.5.6 6.3.5.7]
Organism
bps  Burkholderia pseudomallei K96243
Pathway
bps00970  Aminoacyl-tRNA biosynthesis
bps01100  Metabolic pathways
Brite
KEGG Orthology (KO) [BR:bps00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BPSS1659
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03029 Mitochondrial biogenesis [BR:bps03029]
    BPSS1659
Enzymes [BR:bps01000]
 6. Ligases
  6.3  Forming carbon-nitrogen bonds
   6.3.5  Carbon-nitrogen ligases with glutamine as amido-N-donor
    6.3.5.6  asparaginyl-tRNA synthase (glutamine-hydrolysing)
     BPSS1659
    6.3.5.7  glutaminyl-tRNA synthase (glutamine-hydrolysing)
     BPSS1659
Mitochondrial biogenesis [BR:bps03029]
 Mitochondrial DNA transcription, translation, and replication factors
  Mitochondrial transcription and translation factors
   Other mitochondrial DNA transcription and translation factors
    BPSS1659
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Amidase
Motif
Other DBs
NCBI-GeneID: 3096460
NCBI-ProteinID: YP_111665
UniProt: Q63JQ7
Position
2:2280838..2281125
Genome map
AA seq 95 aa AA seqDB search
MRRGTLPDDRRGEVCAVSVSIGAGAAGDVSPQLRQRHLSPVELTQAMLARIAQLDVHLNA
YIRVTAESALADARCAEQEIARGINRDRCMASRLR
NT seq 288 nt NT seq  +upstreamnt  +downstreamnt
gtgcgccggggcaccctgcccgacgatcgccgcggcgaggtctgcgccgtttctgtttca
ataggcgccggtgcggcaggcgatgtatcgccgcaattgcgacaacgacacctgtcgcca
gtggaattgacgcaggcaatgcttgctcgcatcgcgcaactcgatgtgcatctgaacgcg
tacatccgcgtcacggcggaatccgcgctcgccgacgcccgatgcgccgagcaagagatc
gcgcgcggaatcaaccgggaccgttgcatggcgtcccggttgcggtaa

DBGET integrated database retrieval system