KEGG   Bordetella petrii: Bpet4281Help
Entry
Bpet4281          CDS       T00637                                 

Definition
(GenBank) putative lipoprotein
Organism
bpt  Bordetella petrii
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: CAP44630
UniProt: A9IAU5
Position
complement(4538127..4538705)
Genome map
AA seq 192 aa AA seqDB search
MPAIPVSRRLVGAGLLAAALASGCATTTAPLVPDAIEGVSSAPEPEAPEFIPVVRYGRYT
LVELAPTAAQRDLLLQTIDVSMPEDARATVGDGLRHVLKRSGYQLCETPSAVTELYALPL
PAAHRHLGPMTLRDALLTLAGPAWELHADERARQICFEQPGGSATAEHAHEPPVAEAVQT
FPLMPSVSGGQP
NT seq 579 nt NT seq  +upstreamnt  +downstreamnt
atgcccgcaatccctgtatcccggcgtctggtcggcgctggtctcctggccgcagcgctg
gccagcggctgcgcgaccaccaccgcgccgctggtgccagacgccatagaaggcgtctcc
tccgctcccgaacccgaggcacccgagttcattcccgtcgtgcgctatggccgctacacg
ctggtcgagctggcacccacggcggcgcagcgtgacttgctgttgcagaccatcgacgtg
tccatgcccgaggatgcccgcgccacggtgggcgatgggctgcggcatgtgctcaaacgc
agtggctaccagctttgcgagacgcccagcgccgtgaccgagttgtatgcgctgccgctg
ccggcggcgcaccggcatcttggccccatgaccttgcgcgatgcgctgctcaccctggcc
ggcccggcctgggaactgcatgcggatgaacgggcacggcagatttgctttgagcagcct
ggaggcagtgcgaccgccgagcacgcacacgagccgcctgttgccgaggcggtgcagacg
tttccgctgatgccttcggtttcgggaggccagccatga

DBGET integrated database retrieval system