KEGG   Bacillus pumilus SAFR-032: BPUM_nc0005Help
Entry
BPUM_nc0005       ncRNA     T00599                                 

Gene name
scr
Definition
(GenBank) signal recognition particle-like (SRP) RNA component
  KO
K01983  SRP RNA
Organism
bpu  Bacillus pumilus SAFR-032
Pathway
bpu03060  Protein export
Brite
KEGG Orthology (KO) [BR:bpu00001]
 09120 Genetic Information Processing
  09123 Folding, sorting and degradation
   03060 Protein export
    BPUM_nc0005 (scr)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bpu03100]
    BPUM_nc0005 (scr)
Non-coding RNAs [BR:bpu03100]
 Other RNA
  Signal recognition particle
   BPUM_nc0005 (scr)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
28611..28902
Genome map
NT seq 292 nt NT seq  +upstreamnt  +downstreamnt
aatttaatattcattttgccgtgctaagcggggaggtagcggtgccctgtactcgcaatc
cgctctagcgaggccgaatcccttctcaaggttcgtttacttcaaggtctgccttaaata
agtggtgttgacgtctgggtcctgcgcaatgggaattcatgaaccatgtcaggtccggaa
ggaagcagcattaagtgaaacctctcatgtgccgcagggttgcctgggccgagctaactg
tttaagtaacgcttggggtagcgaatcgacagaaggtgcacggtaaatcaat

DBGET integrated database retrieval system