KEGG   Bartonella quintana RM-11: RM11_0799Help
Entry
RM11_0799         tRNA      T02294                                 

Definition
(GenBank) tRNA-Asn
  KO
K14220  tRNA Asn
Organism
bqr  Bartonella quintana RM-11
Pathway
bqr00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bqr00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    RM11_0799
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bqr03100]
    RM11_0799
Non-coding RNAs [BR:bqr03100]
 Transfer RNA
  tRNA
   RM11_0799
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 13563672
Position
986906..986980
Genome map
NT seq 75 nt NT seq  +upstreamnt  +downstreamnt
tccccggtagctcagtggtagagcaaccggctgttaaccggttggtcgctggttcgaatc
cggcccggggagcca

DBGET integrated database retrieval system