KEGG   Bacillus subtilis subsp. spizizenii TU-B-10: GYO_0780Help
Entry
GYO_0780          CDS       T01635                                 

Definition
(GenBank) MTA/SAH nucleosidase, C-region
Organism
bst  Bacillus subtilis subsp. spizizenii TU-B-10
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AEP85477
UniProt: G4NR08
Position
709255..709392
Genome map
AA seq 45 aa AA seqDB search
MDRWVNETFSIQQIHILNKSDFVNTILQKYVIQHAAVVGDRLSDI
NT seq 138 nt NT seq  +upstreamnt  +downstreamnt
atggacaggtgggtaaatgaaacatttagtattcaacaaatacatattcttaataaaagt
gatttcgttaatactattctgcaaaaatacgtcattcaacatgcagcagttgtcggagac
cgtctatctgacatataa

DBGET integrated database retrieval system