KEGG   Bacillus subtilis subsp. subtilis 168: BSU03570Help
Entry
BSU03570          gene      T00010                                 

Gene name
sfp
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 2914216
Pasteur: BG10176
Position
complement(407638..408135)
Genome map
NT seq 498 nt NT seq  +upstreamnt  +downstreamnt
atgaagatttacggaatttatatggaccgcccgctttcacaggaagaaaatgaacggttc
atgtctttcatatcacctgaaaaacgggagaaatgccggagattttatcataaagaagat
gctcaccgcaccctgctgggagatgtgctcgttcgctcagtcataagcaggcagtatcag
ttggacaaatccgatatccgctttagcacgcaggaatacgggaagccgtgcatccctgat
cttcccgacgctcatttcaacatttctcactccggacgctgggtcatttgcgcgtttgat
tcacagccgatcggcatagatatcgaaaaaacgaaaccgatcagccttgagatcgccaag
cgcttcttttcaaaaacagagtacagcgaccttttagcaaaagacaaggacgagcagaca
gactatttttatcatctatggtcaatgaaagaaagctttatcaaacaaggaaggcaaagg
cttatcgcttccgcttga

DBGET integrated database retrieval system