KEGG   Bacillus subtilis subsp. subtilis 168: BSU03780Help
Entry
BSU03780          CDS       T00010                                 

Gene name
phrC
Definition
(RefSeq) phosphatase RapC inhibitor
  KO
K06353  phosphatase RapC regulator
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu02024  Quorum sensing
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09140 Cellular Processes
  09145 Cellular community - prokaryotes
   02024 Quorum sensing
    BSU03780 (phrC)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: PhrC_PhrF CLLAC
Motif
Other DBs
NCBI-GeneID: 938281
NCBI-ProteinID: NP_388260
Pasteur: BG11959
BSORF: BG11959
UniProt: P94416
Position
429963..430085
Genome map
AA seq 40 aa AA seqDB search
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT
NT seq 123 nt NT seq  +upstreamnt  +downstreamnt
atgaaattgaaatctaagttgtttgttatttgtttggccgcagccgcgatttttacagcg
gctggcgtttctgctaatgcggaagcactcgactttcatgtgacagaaagaggaatgacg
taa

DBGET integrated database retrieval system