KEGG   Bacillus subtilis subsp. subtilis 168: BSU03789Help
Entry
BSU03789          CDS       T00010                                 

Gene name
yczN
Definition
(RefSeq) hypothetical protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: YjcZ_2 DUF3309
Motif
Other DBs
NCBI-GeneID: 8302990
NCBI-ProteinID: YP_003097677
UniProt: C0H3V1
Position
complement(430356..430469)
Genome map
AA seq 37 aa AA seqDB search
MSGYSNGGGYGGISSFALIVVLFILLIIVGTAFVGGF
NT seq 114 nt NT seq  +upstreamnt  +downstreamnt
atgtcaggatactctaacggcggcggttacggcggcatcagttctttcgctttaatcgtt
gtattgtttattctattaattatcgtagggactgcgtttgttggcggcttctaa

DBGET integrated database retrieval system