KEGG   Bacillus subtilis subsp. subtilis 168: BSU05343
Entry
BSU05343          gene      T00010                                 

Symbol
ydzS
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8303151
Position
581228..581329
NT seq 102 nt   +upstreamnt  +downstreamnt
tgcactggtaactcttgccgcagccaaatggctgaagggtgggggagaaaataccttggg
gctaagtggaatgtgtacagcgcaggaatcgaagctcaagga

DBGET integrated database retrieval system