KEGG   Bacillus subtilis subsp. subtilis 168: BSU05344
Entry
BSU05344          gene      T00010                                 

Symbol
ydzS
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8302948
Position
581341..581454
NT seq 114 nt   +upstreamnt  +downstreamnt
gctgtcaaagcaatgaaagaagcagggattgatatttcaaatcaaacatcggagaaattt
gatgatccggcaaaagcacacggaacagaagaagtgtttccaaagggtccgtga

DBGET integrated database retrieval system