KEGG   Bacillus subtilis subsp. subtilis 168: BSU05890
Entry
BSU05890          gene      T00010                                 

Symbol
ydhU
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 939883
Pasteur: BG12198
Position
complement(633923..634651)
NT seq 729 nt   +upstreamnt  +downstreamnt
tttttccaaagctctaatttcagaggaaagcagaaacagtaccgcgatctgcttcgcggc
atttttttagaggagattgcccacgttgaactggttcaaaacacaatcaatgctttatta
gatgaatcaggcggtgaaggtgtcggcagtcaaggtacagatcaagcgccacttgatgaa
gcggttaaacatgctaatcctcatcattatattattggagcgcaaagttcccttcctgtt
gatgcagggggcaatccgtggaacgggtcgtgggtgtataaccacggaaacttaattact
gacctgctggataacctgcttcttgagtcgacaggtgtgctgcaaaaaacaagaatttat
gaaatgagctctaatcagacgttccgcgaaacacttgcttttctgattgtacgcgacaat
gctcaccagaatgcattcgcgaaagcgctcgagacattgggcgttgaatgggcgaagctg
ctccctgtgccgaattatgacattaataaatatcctgagtgcagaaagtatgtcgaatta
ggctaccataatacacattttaactttaggttggatgaaacgagaatcagtgaaatctat
caagggaaatctccaagccgaaatggcggagagttacaagtaatagatcctccggcaggg
tttcccgtaccagtgcttcctgaaataccaaatgaacacagtcctgggttaggcgatatg
aatgcttaa

DBGET integrated database retrieval system