KEGG   Bacillus subtilis subsp. subtilis 168: BSU05899
Entry
BSU05899          gene      T00010                                 

Symbol
ydhU
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8303220
Position
complement(634651..634776)
NT seq 126 nt   +upstreamnt  +downstreamnt
atgtattactacaaagaggaactgattaatatcattaaaccggacaagccagacccggca
gctgctaaggtcctgcaggagatattaggcggtcattacggagaaatgcgtacaatgatg
cagttt

DBGET integrated database retrieval system