KEGG   Bacillus subtilis subsp. subtilis 168: BSU06034
Entry
BSU06034          gene      T00010                                 

Symbol
ydzT
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8303146
Position
complement(652087..652245)
NT seq 159 nt   +upstreamnt  +downstreamnt
ttgatttatcaagactcatcatttatttttgagcgggaggatggtcatccgcaattaaga
aaggttattgagactagacttaaacggctgctcaaaaaagctgggataaaaagaatgtca
ccccccactcttttaggcatacccatacctccttactaa

DBGET integrated database retrieval system