KEGG   Bacillus subtilis subsp. subtilis 168: BSU06038
Entry
BSU06038          gene      T00010                                 

Symbol
ydzT
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8303168
Position
complement(652713..653018)
NT seq 306 nt   +upstreamnt  +downstreamnt
gtggagttatcatatctactaggcattgaccctttaaccaaaaaacgtctagaaatatcc
aaaggaagatttaaaacaaagaaagaagccccagtagcagcccgtcacgtagaactccaa
aacgacaacgggacttttattaaggagtcagatatgcccttcaaaacatttgcaaaaggt
tggcttaagatttacaaccggagtggggtaaaaataagcagtgtacgggccagtgaaaag
aaaatgatgcattttatcgcagtattgggtcaatacccgattagcaaaacacaaaaaaat
gtatga

DBGET integrated database retrieval system