KEGG   Bacillus subtilis subsp. subtilis 168: BSU06049
Entry
BSU06049          gene      T00010                                 

Symbol
ydzV
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8303171
Position
654333..654692
NT seq 360 nt   +upstreamnt  +downstreamnt
ttgaagaatagctcatcatggcgtgtaggagtgattcacccttttaagaaactgtctaat
atcgaaagaaacagtgttcattatgaactagcctcaaacgataacggacgcgaaaaaaag
gatatagttcctgctagtgttatatcaccaagcgggagttgcttttcattggcggataat
gggctagttgagaaggaagggcaaaaaatgaagctgacagagagacaacgacgcttttgt
gatttctttacagaaactagaaatacaacagaggctacgcgtctagccggaaacaaaggg
aaaaatctcaacagagtagcttctcaaaacttgtcaaaactagacattcaaactatatag

DBGET integrated database retrieval system