KEGG   Bacillus subtilis subsp. subtilis 168: BSU06074
Entry
BSU06074          gene      T00010                                 

Symbol
ydzW
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8303178
Position
complement(658061..658189)
NT seq 129 nt   +upstreamnt  +downstreamnt
atttcactatacgaagctctccttagtattgaagaatatggctactttcaggaaggcctg
cgctcattaacactaaagggaaaagaaggggcagaactgattcagcagaccctcgctgcc
ttccgttct

DBGET integrated database retrieval system