KEGG   Bacillus subtilis subsp. subtilis 168: BSU06078Help
Entry
BSU06078          gene      T00010                                 

Gene name
ydzW
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 8303189
Position
complement(658813..659010)
Genome map
NT seq 198 nt NT seq  +upstreamnt  +downstreamnt
tttgcagtacgtcaccttcatggttttgccggtattgttgtgactgcgagccataacccg
cctgaatacaatggatataaagtttatgggccagatggcggccagcttcctcctagcaaa
gggcctgatcaaaatatagcgcagaggtggacaaggcataccttgaactatttcagaaaa
ctcaaatatttaagatga

DBGET integrated database retrieval system