KEGG   Bacillus subtilis subsp. subtilis 168: BSU07170
Entry
BSU07170          gene      T00010                                 

Symbol
yetI
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 936084
Pasteur: BG12865
Position
786689..787264
NT seq 576 nt   +upstreamnt  +downstreamnt
gtgaatatcgatcaattattatatcaatatatcatagacaacactgcggatattactgag
aaatggttcagtttgcgttgccagctaaaaggcgagctatattccgccagccatttaagt
gaagaaacgaaaacacttttaaccgagcagcatacatttaccaatataacaatcgcaagc
gcatttctggaggatcaaaccgattttcaagaaaacatgacaaaatgggcgcaaaacgtt
gcgaaaaacagggtagagcaggatgttcaagtgcatgaggtcgtagaagccatatccaat
tcaagaatctcattctgggacgcagtcgccacatttataaaagagaatcaggagattgtg
acaaatgaggatgcagaccgatggaaccgcattgtgaatcagtcgttcgataagctgatt
attgaattctccgagcagtaccaaaaattcatgctgatgaggcttacatctcagcaggaa
ctgatctcagagcttggctgcccggtcatttccattgccgatggaatcgggatattgccg
cttatcggctccattgatacaaaacggcacaggtca

DBGET integrated database retrieval system