KEGG   Bacillus subtilis subsp. subtilis 168: BSU07180
Entry
BSU07180          gene      T00010                                 

Symbol
yetI
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 936094
Pasteur: BG12873
Position
787264..787560
NT seq 297 nt   +upstreamnt  +downstreamnt
attttagaaacagtgccggtccgctgtgtcgagagaaaaatcacaagcctcgtcgttgat
ctttcgggtgttccgattgtggataccatggtggctcagcaattgtacaacctgtctaaa
acacttttcttattaggcgtcaaagccgtattttcaggaattcgcccggatgtggcccaa
acatcgattcaattggggcttgattttagtgaatatgaaacgtacggcacgctgaagcag
gcattagaaaacatgggtgtccgctgtattgttgaggaattggaagaaaacaaatag

DBGET integrated database retrieval system