KEGG   Bacillus subtilis subsp. subtilis 168: BSU09259
Entry
BSU09259          gene      T00010                                 

Symbol
yhzG
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8303082
Position
1000027..1000218
NT seq 192 nt   +upstreamnt  +downstreamnt
ttgtatagtggatgtgccttatggagtttctgtattttcgccatttcctatatcatacag
aaaacggctaggcttcacattgctattgcaatggctgtccaagttgtttcgagtgcgacc
tttatcagtacgatgctgagcattgtcactttgcctgttttgctttggaagctgcatcct
ctttcttcttga

DBGET integrated database retrieval system